ID: 1121942347

View in Genome Browser
Species Human (GRCh38)
Location 14:98083104-98083126
Sequence CCTGAGAACCAGAGAGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121942347_1121942352 28 Left 1121942347 14:98083104-98083126 CCATCAACTCTCTGGTTCTCAGG No data
Right 1121942352 14:98083155-98083177 AGCTTGCAGACAGCAGACTGTGG 0: 13
1: 45
2: 203
3: 889
4: 1581
1121942347_1121942353 29 Left 1121942347 14:98083104-98083126 CCATCAACTCTCTGGTTCTCAGG No data
Right 1121942353 14:98083156-98083178 GCTTGCAGACAGCAGACTGTGGG 0: 12
1: 42
2: 188
3: 904
4: 1739
1121942347_1121942349 0 Left 1121942347 14:98083104-98083126 CCATCAACTCTCTGGTTCTCAGG No data
Right 1121942349 14:98083127-98083149 ACTACATCACCAGCTTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121942347 Original CRISPR CCTGAGAACCAGAGAGTTGA TGG (reversed) Intergenic
No off target data available for this crispr