ID: 1121947408

View in Genome Browser
Species Human (GRCh38)
Location 14:98136391-98136413
Sequence GTGAAAGAGGATTCCTCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121947408_1121947414 14 Left 1121947408 14:98136391-98136413 CCCACGGAGGAATCCTCTTTCAC No data
Right 1121947414 14:98136428-98136450 AATGTCAGATCTGATAGTCTTGG No data
1121947408_1121947416 27 Left 1121947408 14:98136391-98136413 CCCACGGAGGAATCCTCTTTCAC No data
Right 1121947416 14:98136441-98136463 ATAGTCTTGGATTTGAAGCTGGG No data
1121947408_1121947415 26 Left 1121947408 14:98136391-98136413 CCCACGGAGGAATCCTCTTTCAC No data
Right 1121947415 14:98136440-98136462 GATAGTCTTGGATTTGAAGCTGG No data
1121947408_1121947413 -9 Left 1121947408 14:98136391-98136413 CCCACGGAGGAATCCTCTTTCAC No data
Right 1121947413 14:98136405-98136427 CTCTTTCACAGTGGGTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121947408 Original CRISPR GTGAAAGAGGATTCCTCCGT GGG (reversed) Intergenic
No off target data available for this crispr