ID: 1121954817

View in Genome Browser
Species Human (GRCh38)
Location 14:98204352-98204374
Sequence CCTTCCACTCTGGCCCCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121954817_1121954828 20 Left 1121954817 14:98204352-98204374 CCTACAGGGGCCAGAGTGGAAGG No data
Right 1121954828 14:98204395-98204417 CTGCAGTGCCTCAGAATCAGGGG No data
1121954817_1121954826 18 Left 1121954817 14:98204352-98204374 CCTACAGGGGCCAGAGTGGAAGG No data
Right 1121954826 14:98204393-98204415 GGCTGCAGTGCCTCAGAATCAGG No data
1121954817_1121954823 -3 Left 1121954817 14:98204352-98204374 CCTACAGGGGCCAGAGTGGAAGG No data
Right 1121954823 14:98204372-98204394 AGGTGGGGAGACTTTCCCTCTGG No data
1121954817_1121954827 19 Left 1121954817 14:98204352-98204374 CCTACAGGGGCCAGAGTGGAAGG No data
Right 1121954827 14:98204394-98204416 GCTGCAGTGCCTCAGAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121954817 Original CRISPR CCTTCCACTCTGGCCCCTGT AGG (reversed) Intergenic