ID: 1121960085

View in Genome Browser
Species Human (GRCh38)
Location 14:98251527-98251549
Sequence ATGTTTAAGTAGGAGTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121960082_1121960085 1 Left 1121960082 14:98251503-98251525 CCCTGTGGTGAGAGCATGCACAG No data
Right 1121960085 14:98251527-98251549 ATGTTTAAGTAGGAGTAAGAAGG No data
1121960083_1121960085 0 Left 1121960083 14:98251504-98251526 CCTGTGGTGAGAGCATGCACAGC No data
Right 1121960085 14:98251527-98251549 ATGTTTAAGTAGGAGTAAGAAGG No data
1121960079_1121960085 30 Left 1121960079 14:98251474-98251496 CCAGGCAGGAATCACAGCAGGTG No data
Right 1121960085 14:98251527-98251549 ATGTTTAAGTAGGAGTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121960085 Original CRISPR ATGTTTAAGTAGGAGTAAGA AGG Intergenic
No off target data available for this crispr