ID: 1121962583

View in Genome Browser
Species Human (GRCh38)
Location 14:98275059-98275081
Sequence GCATGGGTCTGCAGGGAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121962583_1121962591 22 Left 1121962583 14:98275059-98275081 CCCCTTTCCCTGCAGACCCATGC No data
Right 1121962591 14:98275104-98275126 GCCCTTACATAGTGACACTGTGG No data
1121962583_1121962590 0 Left 1121962583 14:98275059-98275081 CCCCTTTCCCTGCAGACCCATGC No data
Right 1121962590 14:98275082-98275104 ATCTCTCTTCTAATGAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121962583 Original CRISPR GCATGGGTCTGCAGGGAAAG GGG (reversed) Intergenic
No off target data available for this crispr