ID: 1121976197

View in Genome Browser
Species Human (GRCh38)
Location 14:98406211-98406233
Sequence TGGGCCTCCTAGGGAAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121976191_1121976197 30 Left 1121976191 14:98406158-98406180 CCAATTGATTGATTAGCTACAAG No data
Right 1121976197 14:98406211-98406233 TGGGCCTCCTAGGGAAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121976197 Original CRISPR TGGGCCTCCTAGGGAAATAA AGG Intergenic
No off target data available for this crispr