ID: 1121978166

View in Genome Browser
Species Human (GRCh38)
Location 14:98425691-98425713
Sequence CTGTTGCAGGAGAAGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121978166_1121978169 19 Left 1121978166 14:98425691-98425713 CCTTCATTCTTCTCCTGCAACAG No data
Right 1121978169 14:98425733-98425755 TACTTCATAGCTCTCCACCTGGG No data
1121978166_1121978168 18 Left 1121978166 14:98425691-98425713 CCTTCATTCTTCTCCTGCAACAG No data
Right 1121978168 14:98425732-98425754 CTACTTCATAGCTCTCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121978166 Original CRISPR CTGTTGCAGGAGAAGAATGA AGG (reversed) Intergenic
No off target data available for this crispr