ID: 1121981478

View in Genome Browser
Species Human (GRCh38)
Location 14:98458089-98458111
Sequence TGCCATTGAACTATTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121981478_1121981481 28 Left 1121981478 14:98458089-98458111 CCAGGCACAATAGTTCAATGGCA No data
Right 1121981481 14:98458140-98458162 TCAAATAAATGAAGTGGAGATGG No data
1121981478_1121981480 22 Left 1121981478 14:98458089-98458111 CCAGGCACAATAGTTCAATGGCA No data
Right 1121981480 14:98458134-98458156 ACTCTGTCAAATAAATGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121981478 Original CRISPR TGCCATTGAACTATTGTGCC TGG (reversed) Intergenic
No off target data available for this crispr