ID: 1121990116

View in Genome Browser
Species Human (GRCh38)
Location 14:98549054-98549076
Sequence CAGCCTGATGGCCCGCTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121990116_1121990125 27 Left 1121990116 14:98549054-98549076 CCGCAGAGCGGGCCATCAGGCTG No data
Right 1121990125 14:98549104-98549126 GAAGTTTGAAGGTTGTCTGCTGG No data
1121990116_1121990123 16 Left 1121990116 14:98549054-98549076 CCGCAGAGCGGGCCATCAGGCTG No data
Right 1121990123 14:98549093-98549115 ATCCTGTAGATGAAGTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121990116 Original CRISPR CAGCCTGATGGCCCGCTCTG CGG (reversed) Intergenic
No off target data available for this crispr