ID: 1121990123

View in Genome Browser
Species Human (GRCh38)
Location 14:98549093-98549115
Sequence ATCCTGTAGATGAAGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121990120_1121990123 4 Left 1121990120 14:98549066-98549088 CCATCAGGCTGGAGACCCAGGGA No data
Right 1121990123 14:98549093-98549115 ATCCTGTAGATGAAGTTTGAAGG No data
1121990116_1121990123 16 Left 1121990116 14:98549054-98549076 CCGCAGAGCGGGCCATCAGGCTG No data
Right 1121990123 14:98549093-98549115 ATCCTGTAGATGAAGTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121990123 Original CRISPR ATCCTGTAGATGAAGTTTGA AGG Intergenic
No off target data available for this crispr