ID: 1121990125

View in Genome Browser
Species Human (GRCh38)
Location 14:98549104-98549126
Sequence GAAGTTTGAAGGTTGTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121990121_1121990125 0 Left 1121990121 14:98549081-98549103 CCCAGGGAGCTGATCCTGTAGAT No data
Right 1121990125 14:98549104-98549126 GAAGTTTGAAGGTTGTCTGCTGG No data
1121990120_1121990125 15 Left 1121990120 14:98549066-98549088 CCATCAGGCTGGAGACCCAGGGA No data
Right 1121990125 14:98549104-98549126 GAAGTTTGAAGGTTGTCTGCTGG No data
1121990116_1121990125 27 Left 1121990116 14:98549054-98549076 CCGCAGAGCGGGCCATCAGGCTG No data
Right 1121990125 14:98549104-98549126 GAAGTTTGAAGGTTGTCTGCTGG No data
1121990122_1121990125 -1 Left 1121990122 14:98549082-98549104 CCAGGGAGCTGATCCTGTAGATG No data
Right 1121990125 14:98549104-98549126 GAAGTTTGAAGGTTGTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121990125 Original CRISPR GAAGTTTGAAGGTTGTCTGC TGG Intergenic
No off target data available for this crispr