ID: 1121993575

View in Genome Browser
Species Human (GRCh38)
Location 14:98584440-98584462
Sequence GGCTCTCTTAGAGTTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121993575_1121993582 28 Left 1121993575 14:98584440-98584462 CCTGTCTCAACTCTAAGAGAGCC No data
Right 1121993582 14:98584491-98584513 TTGCACCCACACACAGAGGAAGG No data
1121993575_1121993576 -10 Left 1121993575 14:98584440-98584462 CCTGTCTCAACTCTAAGAGAGCC No data
Right 1121993576 14:98584453-98584475 TAAGAGAGCCTTCACCCAATAGG No data
1121993575_1121993581 24 Left 1121993575 14:98584440-98584462 CCTGTCTCAACTCTAAGAGAGCC No data
Right 1121993581 14:98584487-98584509 TCACTTGCACCCACACACAGAGG No data
1121993575_1121993577 -4 Left 1121993575 14:98584440-98584462 CCTGTCTCAACTCTAAGAGAGCC No data
Right 1121993577 14:98584459-98584481 AGCCTTCACCCAATAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121993575 Original CRISPR GGCTCTCTTAGAGTTGAGAC AGG (reversed) Intergenic