ID: 1121993576

View in Genome Browser
Species Human (GRCh38)
Location 14:98584453-98584475
Sequence TAAGAGAGCCTTCACCCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121993571_1121993576 11 Left 1121993571 14:98584419-98584441 CCCCTCTCTGAAGCTGAATGCCC No data
Right 1121993576 14:98584453-98584475 TAAGAGAGCCTTCACCCAATAGG No data
1121993572_1121993576 10 Left 1121993572 14:98584420-98584442 CCCTCTCTGAAGCTGAATGCCCT No data
Right 1121993576 14:98584453-98584475 TAAGAGAGCCTTCACCCAATAGG No data
1121993575_1121993576 -10 Left 1121993575 14:98584440-98584462 CCTGTCTCAACTCTAAGAGAGCC No data
Right 1121993576 14:98584453-98584475 TAAGAGAGCCTTCACCCAATAGG No data
1121993573_1121993576 9 Left 1121993573 14:98584421-98584443 CCTCTCTGAAGCTGAATGCCCTG No data
Right 1121993576 14:98584453-98584475 TAAGAGAGCCTTCACCCAATAGG No data
1121993570_1121993576 25 Left 1121993570 14:98584405-98584427 CCAGAGGTGAGGCACCCCTCTCT No data
Right 1121993576 14:98584453-98584475 TAAGAGAGCCTTCACCCAATAGG No data
1121993574_1121993576 -9 Left 1121993574 14:98584439-98584461 CCCTGTCTCAACTCTAAGAGAGC No data
Right 1121993576 14:98584453-98584475 TAAGAGAGCCTTCACCCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121993576 Original CRISPR TAAGAGAGCCTTCACCCAAT AGG Intergenic