ID: 1121993577

View in Genome Browser
Species Human (GRCh38)
Location 14:98584459-98584481
Sequence AGCCTTCACCCAATAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121993573_1121993577 15 Left 1121993573 14:98584421-98584443 CCTCTCTGAAGCTGAATGCCCTG No data
Right 1121993577 14:98584459-98584481 AGCCTTCACCCAATAGGAGAAGG No data
1121993571_1121993577 17 Left 1121993571 14:98584419-98584441 CCCCTCTCTGAAGCTGAATGCCC No data
Right 1121993577 14:98584459-98584481 AGCCTTCACCCAATAGGAGAAGG No data
1121993574_1121993577 -3 Left 1121993574 14:98584439-98584461 CCCTGTCTCAACTCTAAGAGAGC No data
Right 1121993577 14:98584459-98584481 AGCCTTCACCCAATAGGAGAAGG No data
1121993575_1121993577 -4 Left 1121993575 14:98584440-98584462 CCTGTCTCAACTCTAAGAGAGCC No data
Right 1121993577 14:98584459-98584481 AGCCTTCACCCAATAGGAGAAGG No data
1121993572_1121993577 16 Left 1121993572 14:98584420-98584442 CCCTCTCTGAAGCTGAATGCCCT No data
Right 1121993577 14:98584459-98584481 AGCCTTCACCCAATAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121993577 Original CRISPR AGCCTTCACCCAATAGGAGA AGG Intergenic