ID: 1121993581

View in Genome Browser
Species Human (GRCh38)
Location 14:98584487-98584509
Sequence TCACTTGCACCCACACACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121993574_1121993581 25 Left 1121993574 14:98584439-98584461 CCCTGTCTCAACTCTAAGAGAGC No data
Right 1121993581 14:98584487-98584509 TCACTTGCACCCACACACAGAGG No data
1121993578_1121993581 3 Left 1121993578 14:98584461-98584483 CCTTCACCCAATAGGAGAAGGTG No data
Right 1121993581 14:98584487-98584509 TCACTTGCACCCACACACAGAGG No data
1121993575_1121993581 24 Left 1121993575 14:98584440-98584462 CCTGTCTCAACTCTAAGAGAGCC No data
Right 1121993581 14:98584487-98584509 TCACTTGCACCCACACACAGAGG No data
1121993579_1121993581 -3 Left 1121993579 14:98584467-98584489 CCCAATAGGAGAAGGTGTGCTCA No data
Right 1121993581 14:98584487-98584509 TCACTTGCACCCACACACAGAGG No data
1121993580_1121993581 -4 Left 1121993580 14:98584468-98584490 CCAATAGGAGAAGGTGTGCTCAC No data
Right 1121993581 14:98584487-98584509 TCACTTGCACCCACACACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121993581 Original CRISPR TCACTTGCACCCACACACAG AGG Intergenic