ID: 1121997993

View in Genome Browser
Species Human (GRCh38)
Location 14:98620319-98620341
Sequence TCTTATATGGACATGGTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121997993_1121997996 25 Left 1121997993 14:98620319-98620341 CCATAAACCATGTCCATATAAGA No data
Right 1121997996 14:98620367-98620389 TGTGTGTTCTAATGCTCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121997993 Original CRISPR TCTTATATGGACATGGTTTA TGG (reversed) Intergenic
No off target data available for this crispr