ID: 1121999948

View in Genome Browser
Species Human (GRCh38)
Location 14:98639068-98639090
Sequence CAGCACATGGATGAGTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121999941_1121999948 30 Left 1121999941 14:98639015-98639037 CCTTGAGGGCAGGGGCTGTGTCT No data
Right 1121999948 14:98639068-98639090 CAGCACATGGATGAGTAGGCAGG No data
1121999944_1121999948 -10 Left 1121999944 14:98639055-98639077 CCTATACCTAGTACAGCACATGG No data
Right 1121999948 14:98639068-98639090 CAGCACATGGATGAGTAGGCAGG No data
1121999942_1121999948 0 Left 1121999942 14:98639045-98639067 CCCTTGTAGTCCTATACCTAGTA No data
Right 1121999948 14:98639068-98639090 CAGCACATGGATGAGTAGGCAGG No data
1121999943_1121999948 -1 Left 1121999943 14:98639046-98639068 CCTTGTAGTCCTATACCTAGTAC No data
Right 1121999948 14:98639068-98639090 CAGCACATGGATGAGTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121999948 Original CRISPR CAGCACATGGATGAGTAGGC AGG Intergenic
No off target data available for this crispr