ID: 1122003630

View in Genome Browser
Species Human (GRCh38)
Location 14:98684650-98684672
Sequence CTGAATTTACCCAGGAACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122003623_1122003630 26 Left 1122003623 14:98684601-98684623 CCTGTGTGGACAATGCGCTTCGA No data
Right 1122003630 14:98684650-98684672 CTGAATTTACCCAGGAACGCAGG No data
1122003628_1122003630 -5 Left 1122003628 14:98684632-98684654 CCAGGATGCTCAGCTGTTCTGAA No data
Right 1122003630 14:98684650-98684672 CTGAATTTACCCAGGAACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122003630 Original CRISPR CTGAATTTACCCAGGAACGC AGG Intergenic
No off target data available for this crispr