ID: 1122004240

View in Genome Browser
Species Human (GRCh38)
Location 14:98688795-98688817
Sequence AGACTCCTCTGCTTCCTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122004240_1122004250 28 Left 1122004240 14:98688795-98688817 CCAAAAAGGAAGCAGAGGAGTCT No data
Right 1122004250 14:98688846-98688868 ATGGTGATTCTGCTTCTACTTGG No data
1122004240_1122004244 -5 Left 1122004240 14:98688795-98688817 CCAAAAAGGAAGCAGAGGAGTCT No data
Right 1122004244 14:98688813-98688835 AGTCTGAACACCAGGGCCTTGGG No data
1122004240_1122004246 9 Left 1122004240 14:98688795-98688817 CCAAAAAGGAAGCAGAGGAGTCT No data
Right 1122004246 14:98688827-98688849 GGCCTTGGGAACCACCATGATGG No data
1122004240_1122004243 -6 Left 1122004240 14:98688795-98688817 CCAAAAAGGAAGCAGAGGAGTCT No data
Right 1122004243 14:98688812-98688834 GAGTCTGAACACCAGGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122004240 Original CRISPR AGACTCCTCTGCTTCCTTTT TGG (reversed) Intergenic
No off target data available for this crispr