ID: 1122004246

View in Genome Browser
Species Human (GRCh38)
Location 14:98688827-98688849
Sequence GGCCTTGGGAACCACCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122004240_1122004246 9 Left 1122004240 14:98688795-98688817 CCAAAAAGGAAGCAGAGGAGTCT No data
Right 1122004246 14:98688827-98688849 GGCCTTGGGAACCACCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122004246 Original CRISPR GGCCTTGGGAACCACCATGA TGG Intergenic
No off target data available for this crispr