ID: 1122004558

View in Genome Browser
Species Human (GRCh38)
Location 14:98691325-98691347
Sequence TGCCTGTCTCTCTATGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122004558_1122004560 11 Left 1122004558 14:98691325-98691347 CCTACCTCATAGAGAGACAGGCA No data
Right 1122004560 14:98691359-98691381 CAATAATGAGTGCAGATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122004558 Original CRISPR TGCCTGTCTCTCTATGAGGT AGG (reversed) Intergenic
No off target data available for this crispr