ID: 1122004560

View in Genome Browser
Species Human (GRCh38)
Location 14:98691359-98691381
Sequence CAATAATGAGTGCAGATATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122004559_1122004560 7 Left 1122004559 14:98691329-98691351 CCTCATAGAGAGACAGGCAGCAT No data
Right 1122004560 14:98691359-98691381 CAATAATGAGTGCAGATATCTGG No data
1122004558_1122004560 11 Left 1122004558 14:98691325-98691347 CCTACCTCATAGAGAGACAGGCA No data
Right 1122004560 14:98691359-98691381 CAATAATGAGTGCAGATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122004560 Original CRISPR CAATAATGAGTGCAGATATC TGG Intergenic
No off target data available for this crispr