ID: 1122008745

View in Genome Browser
Species Human (GRCh38)
Location 14:98728316-98728338
Sequence CTAAGACTCCCCAGGTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122008742_1122008745 20 Left 1122008742 14:98728273-98728295 CCATGTATTGGTAATGTAGCATG No data
Right 1122008745 14:98728316-98728338 CTAAGACTCCCCAGGTAAGCTGG No data
1122008741_1122008745 30 Left 1122008741 14:98728263-98728285 CCAAAGCGGACCATGTATTGGTA No data
Right 1122008745 14:98728316-98728338 CTAAGACTCCCCAGGTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122008745 Original CRISPR CTAAGACTCCCCAGGTAAGC TGG Intergenic
No off target data available for this crispr