ID: 1122008745 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:98728316-98728338 |
Sequence | CTAAGACTCCCCAGGTAAGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1122008742_1122008745 | 20 | Left | 1122008742 | 14:98728273-98728295 | CCATGTATTGGTAATGTAGCATG | No data | ||
Right | 1122008745 | 14:98728316-98728338 | CTAAGACTCCCCAGGTAAGCTGG | No data | ||||
1122008741_1122008745 | 30 | Left | 1122008741 | 14:98728263-98728285 | CCAAAGCGGACCATGTATTGGTA | No data | ||
Right | 1122008745 | 14:98728316-98728338 | CTAAGACTCCCCAGGTAAGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1122008745 | Original CRISPR | CTAAGACTCCCCAGGTAAGC TGG | Intergenic | ||
No off target data available for this crispr |