ID: 1122009756

View in Genome Browser
Species Human (GRCh38)
Location 14:98736441-98736463
Sequence GTCCATGGCAGCCCAGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122009747_1122009756 27 Left 1122009747 14:98736391-98736413 CCATTGAGGCTCTTGTTTAAAAT No data
Right 1122009756 14:98736441-98736463 GTCCATGGCAGCCCAGGCCAGGG No data
1122009751_1122009756 -1 Left 1122009751 14:98736419-98736441 CCACAGTTGAACCTTGGGCAGAG No data
Right 1122009756 14:98736441-98736463 GTCCATGGCAGCCCAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122009756 Original CRISPR GTCCATGGCAGCCCAGGCCA GGG Intergenic
No off target data available for this crispr