ID: 1122013028

View in Genome Browser
Species Human (GRCh38)
Location 14:98769389-98769411
Sequence CCTCCTTAGCATCTATGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122013028_1122013032 7 Left 1122013028 14:98769389-98769411 CCTGGCCATAGATGCTAAGGAGG No data
Right 1122013032 14:98769419-98769441 TCAGATGCCTGAACAGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122013028 Original CRISPR CCTCCTTAGCATCTATGGCC AGG (reversed) Intergenic
No off target data available for this crispr