ID: 1122013036

View in Genome Browser
Species Human (GRCh38)
Location 14:98769470-98769492
Sequence CTGGCAGATGAAGCCTCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122013036_1122013039 -3 Left 1122013036 14:98769470-98769492 CCTACAGAGGCTTCATCTGCCAG No data
Right 1122013039 14:98769490-98769512 CAGCTCCTTATACGGAGCGTTGG No data
1122013036_1122013043 21 Left 1122013036 14:98769470-98769492 CCTACAGAGGCTTCATCTGCCAG No data
Right 1122013043 14:98769514-98769536 AGGAGCCGTTAACTCCAGGAAGG No data
1122013036_1122013040 1 Left 1122013036 14:98769470-98769492 CCTACAGAGGCTTCATCTGCCAG No data
Right 1122013040 14:98769494-98769516 TCCTTATACGGAGCGTTGGAAGG No data
1122013036_1122013042 17 Left 1122013036 14:98769470-98769492 CCTACAGAGGCTTCATCTGCCAG No data
Right 1122013042 14:98769510-98769532 TGGAAGGAGCCGTTAACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122013036 Original CRISPR CTGGCAGATGAAGCCTCTGT AGG (reversed) Intergenic
No off target data available for this crispr