ID: 1122015486

View in Genome Browser
Species Human (GRCh38)
Location 14:98791795-98791817
Sequence ATCAATACACAGAGGAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122015481_1122015486 -6 Left 1122015481 14:98791778-98791800 CCCACTGAATGCTGGAGATCAAT No data
Right 1122015486 14:98791795-98791817 ATCAATACACAGAGGAGGGCTGG No data
1122015482_1122015486 -7 Left 1122015482 14:98791779-98791801 CCACTGAATGCTGGAGATCAATA No data
Right 1122015486 14:98791795-98791817 ATCAATACACAGAGGAGGGCTGG No data
1122015479_1122015486 2 Left 1122015479 14:98791770-98791792 CCTGTGAACCCACTGAATGCTGG No data
Right 1122015486 14:98791795-98791817 ATCAATACACAGAGGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122015486 Original CRISPR ATCAATACACAGAGGAGGGC TGG Intergenic
No off target data available for this crispr