ID: 1122016010

View in Genome Browser
Species Human (GRCh38)
Location 14:98797196-98797218
Sequence TGCCATTACATTCTTAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122016005_1122016010 10 Left 1122016005 14:98797163-98797185 CCCCTCAAAATTCTTTGCTTGTG No data
Right 1122016010 14:98797196-98797218 TGCCATTACATTCTTAGGCAGGG No data
1122016004_1122016010 11 Left 1122016004 14:98797162-98797184 CCCCCTCAAAATTCTTTGCTTGT No data
Right 1122016010 14:98797196-98797218 TGCCATTACATTCTTAGGCAGGG No data
1122016003_1122016010 19 Left 1122016003 14:98797154-98797176 CCTCTAAACCCCCTCAAAATTCT No data
Right 1122016010 14:98797196-98797218 TGCCATTACATTCTTAGGCAGGG No data
1122016001_1122016010 23 Left 1122016001 14:98797150-98797172 CCCTCCTCTAAACCCCCTCAAAA No data
Right 1122016010 14:98797196-98797218 TGCCATTACATTCTTAGGCAGGG No data
1122016006_1122016010 9 Left 1122016006 14:98797164-98797186 CCCTCAAAATTCTTTGCTTGTGT No data
Right 1122016010 14:98797196-98797218 TGCCATTACATTCTTAGGCAGGG No data
1122016007_1122016010 8 Left 1122016007 14:98797165-98797187 CCTCAAAATTCTTTGCTTGTGTT No data
Right 1122016010 14:98797196-98797218 TGCCATTACATTCTTAGGCAGGG No data
1122016002_1122016010 22 Left 1122016002 14:98797151-98797173 CCTCCTCTAAACCCCCTCAAAAT No data
Right 1122016010 14:98797196-98797218 TGCCATTACATTCTTAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122016010 Original CRISPR TGCCATTACATTCTTAGGCA GGG Intergenic
No off target data available for this crispr