ID: 1122018344

View in Genome Browser
Species Human (GRCh38)
Location 14:98816398-98816420
Sequence GGGCCGCTAGGCTGGTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122018344_1122018351 16 Left 1122018344 14:98816398-98816420 CCAGAGGACCAGCCTAGCGGCCC No data
Right 1122018351 14:98816437-98816459 GCGCCGTGCTGTCCTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122018344 Original CRISPR GGGCCGCTAGGCTGGTCCTC TGG (reversed) Intergenic
No off target data available for this crispr