ID: 1122018345 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:98816406-98816428 |
Sequence | GAAGTATCGGGCCGCTAGGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1122018345_1122018355 | 29 | Left | 1122018345 | 14:98816406-98816428 | CCAGCCTAGCGGCCCGATACTTC | No data | ||
Right | 1122018355 | 14:98816458-98816480 | GGCACTGAACACCTTCCACATGG | No data | ||||
1122018345_1122018351 | 8 | Left | 1122018345 | 14:98816406-98816428 | CCAGCCTAGCGGCCCGATACTTC | No data | ||
Right | 1122018351 | 14:98816437-98816459 | GCGCCGTGCTGTCCTGTTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1122018345 | Original CRISPR | GAAGTATCGGGCCGCTAGGC TGG (reversed) | Intergenic | ||