ID: 1122018345

View in Genome Browser
Species Human (GRCh38)
Location 14:98816406-98816428
Sequence GAAGTATCGGGCCGCTAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122018345_1122018351 8 Left 1122018345 14:98816406-98816428 CCAGCCTAGCGGCCCGATACTTC No data
Right 1122018351 14:98816437-98816459 GCGCCGTGCTGTCCTGTTCCAGG No data
1122018345_1122018355 29 Left 1122018345 14:98816406-98816428 CCAGCCTAGCGGCCCGATACTTC No data
Right 1122018355 14:98816458-98816480 GGCACTGAACACCTTCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122018345 Original CRISPR GAAGTATCGGGCCGCTAGGC TGG (reversed) Intergenic
No off target data available for this crispr