ID: 1122018346

View in Genome Browser
Species Human (GRCh38)
Location 14:98816410-98816432
Sequence GGTGGAAGTATCGGGCCGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122018346_1122018355 25 Left 1122018346 14:98816410-98816432 CCTAGCGGCCCGATACTTCCACC No data
Right 1122018355 14:98816458-98816480 GGCACTGAACACCTTCCACATGG No data
1122018346_1122018351 4 Left 1122018346 14:98816410-98816432 CCTAGCGGCCCGATACTTCCACC No data
Right 1122018351 14:98816437-98816459 GCGCCGTGCTGTCCTGTTCCAGG No data
1122018346_1122018356 29 Left 1122018346 14:98816410-98816432 CCTAGCGGCCCGATACTTCCACC No data
Right 1122018356 14:98816462-98816484 CTGAACACCTTCCACATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122018346 Original CRISPR GGTGGAAGTATCGGGCCGCT AGG (reversed) Intergenic
No off target data available for this crispr