ID: 1122018347

View in Genome Browser
Species Human (GRCh38)
Location 14:98816418-98816440
Sequence GCGCACATGGTGGAAGTATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122018347_1122018355 17 Left 1122018347 14:98816418-98816440 CCCGATACTTCCACCATGTGCGC No data
Right 1122018355 14:98816458-98816480 GGCACTGAACACCTTCCACATGG No data
1122018347_1122018356 21 Left 1122018347 14:98816418-98816440 CCCGATACTTCCACCATGTGCGC No data
Right 1122018356 14:98816462-98816484 CTGAACACCTTCCACATGGTTGG No data
1122018347_1122018351 -4 Left 1122018347 14:98816418-98816440 CCCGATACTTCCACCATGTGCGC No data
Right 1122018351 14:98816437-98816459 GCGCCGTGCTGTCCTGTTCCAGG No data
1122018347_1122018358 28 Left 1122018347 14:98816418-98816440 CCCGATACTTCCACCATGTGCGC No data
Right 1122018358 14:98816469-98816491 CCTTCCACATGGTTGGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122018347 Original CRISPR GCGCACATGGTGGAAGTATC GGG (reversed) Intergenic