ID: 1122018348

View in Genome Browser
Species Human (GRCh38)
Location 14:98816419-98816441
Sequence GGCGCACATGGTGGAAGTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122018348_1122018358 27 Left 1122018348 14:98816419-98816441 CCGATACTTCCACCATGTGCGCC No data
Right 1122018358 14:98816469-98816491 CCTTCCACATGGTTGGTCAGAGG No data
1122018348_1122018356 20 Left 1122018348 14:98816419-98816441 CCGATACTTCCACCATGTGCGCC No data
Right 1122018356 14:98816462-98816484 CTGAACACCTTCCACATGGTTGG No data
1122018348_1122018359 30 Left 1122018348 14:98816419-98816441 CCGATACTTCCACCATGTGCGCC No data
Right 1122018359 14:98816472-98816494 TCCACATGGTTGGTCAGAGGTGG No data
1122018348_1122018351 -5 Left 1122018348 14:98816419-98816441 CCGATACTTCCACCATGTGCGCC No data
Right 1122018351 14:98816437-98816459 GCGCCGTGCTGTCCTGTTCCAGG No data
1122018348_1122018355 16 Left 1122018348 14:98816419-98816441 CCGATACTTCCACCATGTGCGCC No data
Right 1122018355 14:98816458-98816480 GGCACTGAACACCTTCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122018348 Original CRISPR GGCGCACATGGTGGAAGTAT CGG (reversed) Intergenic
No off target data available for this crispr