ID: 1122018351

View in Genome Browser
Species Human (GRCh38)
Location 14:98816437-98816459
Sequence GCGCCGTGCTGTCCTGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122018348_1122018351 -5 Left 1122018348 14:98816419-98816441 CCGATACTTCCACCATGTGCGCC No data
Right 1122018351 14:98816437-98816459 GCGCCGTGCTGTCCTGTTCCAGG No data
1122018347_1122018351 -4 Left 1122018347 14:98816418-98816440 CCCGATACTTCCACCATGTGCGC No data
Right 1122018351 14:98816437-98816459 GCGCCGTGCTGTCCTGTTCCAGG No data
1122018346_1122018351 4 Left 1122018346 14:98816410-98816432 CCTAGCGGCCCGATACTTCCACC No data
Right 1122018351 14:98816437-98816459 GCGCCGTGCTGTCCTGTTCCAGG No data
1122018344_1122018351 16 Left 1122018344 14:98816398-98816420 CCAGAGGACCAGCCTAGCGGCCC No data
Right 1122018351 14:98816437-98816459 GCGCCGTGCTGTCCTGTTCCAGG No data
1122018345_1122018351 8 Left 1122018345 14:98816406-98816428 CCAGCCTAGCGGCCCGATACTTC No data
Right 1122018351 14:98816437-98816459 GCGCCGTGCTGTCCTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122018351 Original CRISPR GCGCCGTGCTGTCCTGTTCC AGG Intergenic
No off target data available for this crispr