ID: 1122018358

View in Genome Browser
Species Human (GRCh38)
Location 14:98816469-98816491
Sequence CCTTCCACATGGTTGGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122018352_1122018358 6 Left 1122018352 14:98816440-98816462 CCGTGCTGTCCTGTTCCAGGCAC No data
Right 1122018358 14:98816469-98816491 CCTTCCACATGGTTGGTCAGAGG No data
1122018347_1122018358 28 Left 1122018347 14:98816418-98816440 CCCGATACTTCCACCATGTGCGC No data
Right 1122018358 14:98816469-98816491 CCTTCCACATGGTTGGTCAGAGG No data
1122018349_1122018358 18 Left 1122018349 14:98816428-98816450 CCACCATGTGCGCCGTGCTGTCC No data
Right 1122018358 14:98816469-98816491 CCTTCCACATGGTTGGTCAGAGG No data
1122018350_1122018358 15 Left 1122018350 14:98816431-98816453 CCATGTGCGCCGTGCTGTCCTGT No data
Right 1122018358 14:98816469-98816491 CCTTCCACATGGTTGGTCAGAGG No data
1122018348_1122018358 27 Left 1122018348 14:98816419-98816441 CCGATACTTCCACCATGTGCGCC No data
Right 1122018358 14:98816469-98816491 CCTTCCACATGGTTGGTCAGAGG No data
1122018353_1122018358 -3 Left 1122018353 14:98816449-98816471 CCTGTTCCAGGCACTGAACACCT No data
Right 1122018358 14:98816469-98816491 CCTTCCACATGGTTGGTCAGAGG No data
1122018354_1122018358 -9 Left 1122018354 14:98816455-98816477 CCAGGCACTGAACACCTTCCACA No data
Right 1122018358 14:98816469-98816491 CCTTCCACATGGTTGGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122018358 Original CRISPR CCTTCCACATGGTTGGTCAG AGG Intergenic