ID: 1122018575

View in Genome Browser
Species Human (GRCh38)
Location 14:98817920-98817942
Sequence GTCCAGCTGGTCCATGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122018575_1122018579 24 Left 1122018575 14:98817920-98817942 CCCAGTCCATGGACCAGCTGGAC No data
Right 1122018579 14:98817967-98817989 TGCATCGCATGAGTGAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122018575 Original CRISPR GTCCAGCTGGTCCATGGACT GGG (reversed) Intergenic
No off target data available for this crispr