ID: 1122018979

View in Genome Browser
Species Human (GRCh38)
Location 14:98820762-98820784
Sequence CTGATGCTCTTGGGGAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122018979_1122018988 1 Left 1122018979 14:98820762-98820784 CCCATTTTCCCCAAGAGCATCAG No data
Right 1122018988 14:98820786-98820808 TGGAAGTGCTTTCATTGGCAGGG No data
1122018979_1122018990 6 Left 1122018979 14:98820762-98820784 CCCATTTTCCCCAAGAGCATCAG No data
Right 1122018990 14:98820791-98820813 GTGCTTTCATTGGCAGGGAAGGG No data
1122018979_1122018987 0 Left 1122018979 14:98820762-98820784 CCCATTTTCCCCAAGAGCATCAG No data
Right 1122018987 14:98820785-98820807 GTGGAAGTGCTTTCATTGGCAGG No data
1122018979_1122018986 -4 Left 1122018979 14:98820762-98820784 CCCATTTTCCCCAAGAGCATCAG No data
Right 1122018986 14:98820781-98820803 TCAGGTGGAAGTGCTTTCATTGG No data
1122018979_1122018989 5 Left 1122018979 14:98820762-98820784 CCCATTTTCCCCAAGAGCATCAG No data
Right 1122018989 14:98820790-98820812 AGTGCTTTCATTGGCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122018979 Original CRISPR CTGATGCTCTTGGGGAAAAT GGG (reversed) Intergenic
No off target data available for this crispr