ID: 1122020667

View in Genome Browser
Species Human (GRCh38)
Location 14:98835093-98835115
Sequence GGCAATCCTGCAATGCTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122020664_1122020667 -3 Left 1122020664 14:98835073-98835095 CCAGTAAGAAGTTCTCAGCAGGC No data
Right 1122020667 14:98835093-98835115 GGCAATCCTGCAATGCTTAGGGG No data
1122020662_1122020667 12 Left 1122020662 14:98835058-98835080 CCAAAGTCAGCAGGACCAGTAAG No data
Right 1122020667 14:98835093-98835115 GGCAATCCTGCAATGCTTAGGGG No data
1122020661_1122020667 13 Left 1122020661 14:98835057-98835079 CCCAAAGTCAGCAGGACCAGTAA No data
Right 1122020667 14:98835093-98835115 GGCAATCCTGCAATGCTTAGGGG No data
1122020660_1122020667 14 Left 1122020660 14:98835056-98835078 CCCCAAAGTCAGCAGGACCAGTA No data
Right 1122020667 14:98835093-98835115 GGCAATCCTGCAATGCTTAGGGG No data
1122020659_1122020667 18 Left 1122020659 14:98835052-98835074 CCAACCCCAAAGTCAGCAGGACC No data
Right 1122020667 14:98835093-98835115 GGCAATCCTGCAATGCTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122020667 Original CRISPR GGCAATCCTGCAATGCTTAG GGG Intergenic
No off target data available for this crispr