ID: 1122023029

View in Genome Browser
Species Human (GRCh38)
Location 14:98854831-98854853
Sequence CCCAAAAAGAAGTCGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122023018_1122023029 8 Left 1122023018 14:98854800-98854822 CCCTCTGACAAGGCACCCAAGAG No data
Right 1122023029 14:98854831-98854853 CCCAAAAAGAAGTCGGGGCTGGG No data
1122023019_1122023029 7 Left 1122023019 14:98854801-98854823 CCTCTGACAAGGCACCCAAGAGT No data
Right 1122023029 14:98854831-98854853 CCCAAAAAGAAGTCGGGGCTGGG No data
1122023021_1122023029 -8 Left 1122023021 14:98854816-98854838 CCAAGAGTGTCCTTCCCCAAAAA No data
Right 1122023029 14:98854831-98854853 CCCAAAAAGAAGTCGGGGCTGGG No data
1122023020_1122023029 -7 Left 1122023020 14:98854815-98854837 CCCAAGAGTGTCCTTCCCCAAAA No data
Right 1122023029 14:98854831-98854853 CCCAAAAAGAAGTCGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122023029 Original CRISPR CCCAAAAAGAAGTCGGGGCT GGG Intergenic
No off target data available for this crispr