ID: 1122023694

View in Genome Browser
Species Human (GRCh38)
Location 14:98859450-98859472
Sequence AAGCTCCCACAGCTTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122023694_1122023705 11 Left 1122023694 14:98859450-98859472 CCAGCCCCAAGCTGTGGGAGCTT No data
Right 1122023705 14:98859484-98859506 AGGTGGTGGCTTCCATCCACAGG No data
1122023694_1122023703 -3 Left 1122023694 14:98859450-98859472 CCAGCCCCAAGCTGTGGGAGCTT No data
Right 1122023703 14:98859470-98859492 CTTGGAGGCCAGGAAGGTGGTGG No data
1122023694_1122023701 -9 Left 1122023694 14:98859450-98859472 CCAGCCCCAAGCTGTGGGAGCTT No data
Right 1122023701 14:98859464-98859486 TGGGAGCTTGGAGGCCAGGAAGG No data
1122023694_1122023702 -6 Left 1122023694 14:98859450-98859472 CCAGCCCCAAGCTGTGGGAGCTT No data
Right 1122023702 14:98859467-98859489 GAGCTTGGAGGCCAGGAAGGTGG No data
1122023694_1122023706 12 Left 1122023694 14:98859450-98859472 CCAGCCCCAAGCTGTGGGAGCTT No data
Right 1122023706 14:98859485-98859507 GGTGGTGGCTTCCATCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122023694 Original CRISPR AAGCTCCCACAGCTTGGGGC TGG (reversed) Intergenic
No off target data available for this crispr