ID: 1122024760

View in Genome Browser
Species Human (GRCh38)
Location 14:98867688-98867710
Sequence CTGGAAAGAATCAGATTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122024760_1122024769 29 Left 1122024760 14:98867688-98867710 CCTGCAAATCTGATTCTTTCCAG No data
Right 1122024769 14:98867740-98867762 AATGTGCCCTGGAAGGGATATGG No data
1122024760_1122024763 18 Left 1122024760 14:98867688-98867710 CCTGCAAATCTGATTCTTTCCAG No data
Right 1122024763 14:98867729-98867751 TTCTCCTCCCAAATGTGCCCTGG No data
1122024760_1122024766 23 Left 1122024760 14:98867688-98867710 CCTGCAAATCTGATTCTTTCCAG No data
Right 1122024766 14:98867734-98867756 CTCCCAAATGTGCCCTGGAAGGG No data
1122024760_1122024765 22 Left 1122024760 14:98867688-98867710 CCTGCAAATCTGATTCTTTCCAG No data
Right 1122024765 14:98867733-98867755 CCTCCCAAATGTGCCCTGGAAGG No data
1122024760_1122024770 30 Left 1122024760 14:98867688-98867710 CCTGCAAATCTGATTCTTTCCAG No data
Right 1122024770 14:98867741-98867763 ATGTGCCCTGGAAGGGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122024760 Original CRISPR CTGGAAAGAATCAGATTTGC AGG (reversed) Intergenic
No off target data available for this crispr