ID: 1122027694

View in Genome Browser
Species Human (GRCh38)
Location 14:98889464-98889486
Sequence CAGTGGGGCTGGAGTGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122027685_1122027694 8 Left 1122027685 14:98889433-98889455 CCTGAGTGACCTTAGGCAGGAGC No data
Right 1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG No data
1122027682_1122027694 29 Left 1122027682 14:98889412-98889434 CCAGGCACAGAGGACTGCTGACC No data
Right 1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG No data
1122027687_1122027694 -1 Left 1122027687 14:98889442-98889464 CCTTAGGCAGGAGCAGGAAAGCC No data
Right 1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122027694 Original CRISPR CAGTGGGGCTGGAGTGTAGA GGG Intergenic
No off target data available for this crispr