ID: 1122030150

View in Genome Browser
Species Human (GRCh38)
Location 14:98906171-98906193
Sequence CAGAGTCAACATTAGGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122030150_1122030154 -10 Left 1122030150 14:98906171-98906193 CCTCTATCCTAATGTTGACTCTG No data
Right 1122030154 14:98906184-98906206 GTTGACTCTGCAGGCTTTCAGGG No data
1122030150_1122030160 21 Left 1122030150 14:98906171-98906193 CCTCTATCCTAATGTTGACTCTG No data
Right 1122030160 14:98906215-98906237 CCATCCAGTCCCCCTCCTGTGGG No data
1122030150_1122030155 -9 Left 1122030150 14:98906171-98906193 CCTCTATCCTAATGTTGACTCTG No data
Right 1122030155 14:98906185-98906207 TTGACTCTGCAGGCTTTCAGGGG No data
1122030150_1122030158 20 Left 1122030150 14:98906171-98906193 CCTCTATCCTAATGTTGACTCTG No data
Right 1122030158 14:98906214-98906236 GCCATCCAGTCCCCCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122030150 Original CRISPR CAGAGTCAACATTAGGATAG AGG (reversed) Intergenic
No off target data available for this crispr