ID: 1122030197

View in Genome Browser
Species Human (GRCh38)
Location 14:98906407-98906429
Sequence CTCCATATGACCATGGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122030194_1122030197 -3 Left 1122030194 14:98906387-98906409 CCGAAGGGGACAAAAGCTAACTC No data
Right 1122030197 14:98906407-98906429 CTCCATATGACCATGGTGTTGGG No data
1122030190_1122030197 25 Left 1122030190 14:98906359-98906381 CCTCAGGTGGAGAATCTGGCTAG No data
Right 1122030197 14:98906407-98906429 CTCCATATGACCATGGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122030197 Original CRISPR CTCCATATGACCATGGTGTT GGG Intergenic
No off target data available for this crispr