ID: 1122034614

View in Genome Browser
Species Human (GRCh38)
Location 14:98938261-98938283
Sequence GGCCACACTGGACCACACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122034610_1122034614 -1 Left 1122034610 14:98938239-98938261 CCGGGGCAGAAGGCAGAGACTGG No data
Right 1122034614 14:98938261-98938283 GGCCACACTGGACCACACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122034614 Original CRISPR GGCCACACTGGACCACACTC AGG Intergenic
No off target data available for this crispr