ID: 1122038087

View in Genome Browser
Species Human (GRCh38)
Location 14:98962750-98962772
Sequence CAGCCCAGGGGAGCACGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122038077_1122038087 8 Left 1122038077 14:98962719-98962741 CCCCAGCCATGGAGGCAGAGAAG No data
Right 1122038087 14:98962750-98962772 CAGCCCAGGGGAGCACGCGCGGG No data
1122038074_1122038087 21 Left 1122038074 14:98962706-98962728 CCGATGGTGCAGGCCCCAGCCAT No data
Right 1122038087 14:98962750-98962772 CAGCCCAGGGGAGCACGCGCGGG No data
1122038080_1122038087 2 Left 1122038080 14:98962725-98962747 CCATGGAGGCAGAGAAGCACTAA No data
Right 1122038087 14:98962750-98962772 CAGCCCAGGGGAGCACGCGCGGG No data
1122038079_1122038087 6 Left 1122038079 14:98962721-98962743 CCAGCCATGGAGGCAGAGAAGCA No data
Right 1122038087 14:98962750-98962772 CAGCCCAGGGGAGCACGCGCGGG No data
1122038078_1122038087 7 Left 1122038078 14:98962720-98962742 CCCAGCCATGGAGGCAGAGAAGC No data
Right 1122038087 14:98962750-98962772 CAGCCCAGGGGAGCACGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122038087 Original CRISPR CAGCCCAGGGGAGCACGCGC GGG Intergenic
No off target data available for this crispr