ID: 1122040251

View in Genome Browser
Species Human (GRCh38)
Location 14:98982626-98982648
Sequence TGCATAATGGAGGTAAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122040251_1122040258 22 Left 1122040251 14:98982626-98982648 CCAGTTCTTACCTCCATTATGCA No data
Right 1122040258 14:98982671-98982693 GAGGTGGAATGGCTTGCCCAAGG No data
1122040251_1122040255 3 Left 1122040251 14:98982626-98982648 CCAGTTCTTACCTCCATTATGCA No data
Right 1122040255 14:98982652-98982674 TAGGAATCTGAAATGCAGAGAGG No data
1122040251_1122040256 6 Left 1122040251 14:98982626-98982648 CCAGTTCTTACCTCCATTATGCA No data
Right 1122040256 14:98982655-98982677 GAATCTGAAATGCAGAGAGGTGG No data
1122040251_1122040257 11 Left 1122040251 14:98982626-98982648 CCAGTTCTTACCTCCATTATGCA No data
Right 1122040257 14:98982660-98982682 TGAAATGCAGAGAGGTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122040251 Original CRISPR TGCATAATGGAGGTAAGAAC TGG (reversed) Intergenic
No off target data available for this crispr