ID: 1122040258

View in Genome Browser
Species Human (GRCh38)
Location 14:98982671-98982693
Sequence GAGGTGGAATGGCTTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122040251_1122040258 22 Left 1122040251 14:98982626-98982648 CCAGTTCTTACCTCCATTATGCA No data
Right 1122040258 14:98982671-98982693 GAGGTGGAATGGCTTGCCCAAGG No data
1122040253_1122040258 12 Left 1122040253 14:98982636-98982658 CCTCCATTATGCAGACTAGGAAT No data
Right 1122040258 14:98982671-98982693 GAGGTGGAATGGCTTGCCCAAGG No data
1122040250_1122040258 23 Left 1122040250 14:98982625-98982647 CCCAGTTCTTACCTCCATTATGC No data
Right 1122040258 14:98982671-98982693 GAGGTGGAATGGCTTGCCCAAGG No data
1122040254_1122040258 9 Left 1122040254 14:98982639-98982661 CCATTATGCAGACTAGGAATCTG No data
Right 1122040258 14:98982671-98982693 GAGGTGGAATGGCTTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122040258 Original CRISPR GAGGTGGAATGGCTTGCCCA AGG Intergenic
No off target data available for this crispr