ID: 1122040526

View in Genome Browser
Species Human (GRCh38)
Location 14:98984671-98984693
Sequence TGCCCCCGCGTGTCTCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122040522_1122040526 0 Left 1122040522 14:98984648-98984670 CCCTAAAACACTGTTCTCTCTTT No data
Right 1122040526 14:98984671-98984693 TGCCCCCGCGTGTCTCAAAGGGG No data
1122040520_1122040526 15 Left 1122040520 14:98984633-98984655 CCAGCTCTAAGGATCCCCTAAAA No data
Right 1122040526 14:98984671-98984693 TGCCCCCGCGTGTCTCAAAGGGG No data
1122040523_1122040526 -1 Left 1122040523 14:98984649-98984671 CCTAAAACACTGTTCTCTCTTTT No data
Right 1122040526 14:98984671-98984693 TGCCCCCGCGTGTCTCAAAGGGG No data
1122040521_1122040526 1 Left 1122040521 14:98984647-98984669 CCCCTAAAACACTGTTCTCTCTT No data
Right 1122040526 14:98984671-98984693 TGCCCCCGCGTGTCTCAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122040526 Original CRISPR TGCCCCCGCGTGTCTCAAAG GGG Intergenic