ID: 1122043560

View in Genome Browser
Species Human (GRCh38)
Location 14:99007583-99007605
Sequence AGGCTCAGTAATAGCCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122043560_1122043568 18 Left 1122043560 14:99007583-99007605 CCTGCCTGGCTATTACTGAGCCT No data
Right 1122043568 14:99007624-99007646 GACACCAGCTTGGTGTTTTCCGG No data
1122043560_1122043563 -5 Left 1122043560 14:99007583-99007605 CCTGCCTGGCTATTACTGAGCCT No data
Right 1122043563 14:99007601-99007623 AGCCTCGGTTTCCATGAACTAGG No data
1122043560_1122043567 8 Left 1122043560 14:99007583-99007605 CCTGCCTGGCTATTACTGAGCCT No data
Right 1122043567 14:99007614-99007636 ATGAACTAGGGACACCAGCTTGG No data
1122043560_1122043564 -4 Left 1122043560 14:99007583-99007605 CCTGCCTGGCTATTACTGAGCCT No data
Right 1122043564 14:99007602-99007624 GCCTCGGTTTCCATGAACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122043560 Original CRISPR AGGCTCAGTAATAGCCAGGC AGG (reversed) Intergenic
No off target data available for this crispr